90
|
GeNOsys Inc
double-stranded oligonucleotide of the mef2 dna-binding site in the mouse cox-2 promoter (catttcattaaaaatagaagaa) Double Stranded Oligonucleotide Of The Mef2 Dna Binding Site In The Mouse Cox 2 Promoter (Catttcattaaaaatagaagaa), supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/oligonucleotides+containing+different+cox-2+promoter+sites/double+stranded+oligonucleotide+of+the+mef2+dna+binding+site+in+the+mouse+cox+2+promoter++catttcattaaaaatagaagaa+/10__1074_slash_jbc__m209016200-86-2-17 Average 90 stars, based on 1 article reviews
double-stranded oligonucleotide of the mef2 dna-binding site in the mouse cox-2 promoter (catttcattaaaaatagaagaa) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |